IUBio GIL .. BIOSCI/Bionet News .. Biosequences .. Software .. FTP

problem with blast

Will Nelson wnelson at cmgm.stanford.edu
Thu Jan 21 18:14:58 EST 1993


I have been having a problem with blastn.
The problem is that on successive invocations of blastn,
I get different results, using the same input sequence.

My input file is this:


>DROSATA - LOCUS       DROSATA       254 bp ds-DNA             INV       15-MAR-1989
canatttgcaaatttaatgaaccccccttcaaaaaatgcgaaaattaacgcaaaaattgatttccctaaa
tccttcaaaaagtaaataacaactttttggcaaaatctgattccctaatttcggtcattaaataatcagt
ttttttgccacaactttaaaaataattgtctgaatatggaatgtcatacctcgcnnagctngtaattaaa
tttccaatgaaactgtgttcaacaatgaaaattacatttttcgg

Here is the beginning of the output of diff of the blast results:


1,4c1,2
< Script started on Thu Jan 21 14:57:54 1993
< cmgm.stanford.edu%<1>which script
< /usr/ucb/script
< cmgm.stanford.edu%<2>bl  which blast
---
> Script started on Thu Jan 21 15:00:08 1993
> cmgm.stanford.edu%<1>which blast
6c4
< cmgm.stanford.edu%<3>blast
---
> cmgm.stanford.edu%<2>blast
60,69c58,67
< DROSATA   drosophila 1.688 g/ml satellite repeating unit.     1252  4.0e-97   1
< DRO16883C D.melanogaster untranscribed DNA 1688-3C             459  1.6e-39   2
< DROREP1   Repetitive DNA from Drosophila satellite fracti...   567  1.7e-38   1
< DROSATB   drosophila 1.688 g/ml satellite repeating unit.      567  1.7e-38   1
< DRO1688ED D.melanogaster untranscribed DNA 1688-10Ed           490  7.0e-32   1
< DRO1688EP D.melanogaster untranscribed DNA 1688-10Ep           466  7.8e-30   1
< DROSAT353 D.melanogaster 1.688 g/ml satellite DNA sequence.    438  1.9e-27   1
< DROARS413 d. melanogaster autonomous replication sequence...   355  2.0e-20   1
< DROARS410 d. melanogaster autonomous replication sequence...   350  5.3e-20   1
< DRODMRA   D.melanogaster dispersed middle repetitive DNA ...   255  6.5e-20   2
---
> DROSATA   drosophila 1.688 g/ml satellite repeating unit.     1234  1.3e-95   1
> DRO16883C D.melanogaster untranscribed DNA 1688-3C             450  5.4e-38   2
> DROREP1   Repetitive DNA from Drosophila satellite fracti...   558  1.0e-37   1
> DROSATB   drosophila 1.688 g/ml satellite repeating unit.      558  1.0e-37   1
> DRO1688ED D.melanogaster untranscribed DNA 1688-10Ed           481  4.1e-31   1
> DRO1688EP D.melanogaster untranscribed DNA 1688-10Ep           457  4.5e-29   1
> DROSAT353 D.melanogaster 1.688 g/ml satellite DNA sequence.    429  1.1e-26   1
> DRODMRA   D.melanogaster dispersed middle repetitive DNA ...   246  6.5e-20   2
> DROARS413 d. melanogaster autonomous replication sequence...   346  1.2e-19   1
> DROARS410 d. melanogaster autonomous replication sequence...   341  3.1e-19   1
71c69
< DRODMRC   D.melanogaster dispersed middle repetitive DNA ...   213  6.8e-17   2

Has anyone else seen anything like this?
--
Will Nelson
Computer Resource Administrator
The Beckman Center at Stanford
will at cmgm.stanford.edu




More information about the Bio-soft mailing list

Send comments to us at archive@iubioarchive.bio.net