IUBio GIL .. BIOSCI/Bionet News .. Biosequences .. Software .. FTP

Sequence names in stand-alone BLAST changed to numbers?

Rob Kirkpatrick biohazardude at yahoo.ca
Tue Oct 2 04:49:12 EST 2001


I've recently started using standalone BLAST, but I've found that when
the BLAST report is made, the program has replaced the Sequence Names
with numbers.  Is there a flag or something to tell it not to do this?
 Or, is there a simple way to match up the numbers with the sequences?
 It seems they aren't just in order as they appear in the one-line
descriptions where the scores appear.

Here is an example:

QUERY 201 ctgggtgcaatcttgccccaaccccatgactgtgttctggtccaagatggcacagagcatg
4     1   .............................................................
7     1   ......t.......................c..c.................g.........
5     1   .............................................................

Where 4, 7 and 5 used to be sequence names, but are not neccesarily
the 4th, 5th and 7th sequences in the one-line descriptions.  I don't
know what other info you might need to know what's going on, but I'm
running this with the "-m 3" flag to get flat, master-slave, show

Thanks in advance,



More information about the Bio-soft mailing list

Send comments to us at archive@iubioarchive.bio.net