IUBio GIL .. BIOSCI/Bionet News .. Biosequences .. Software .. FTP

Read and View (Java) ABI trace file,

Victor Solovyev solovyev at sanger.ac.uk
Wed May 19 12:55:24 EST 1999


 We installed ABIQ - Read and View ABI trace file and potential
                     Error positions

 ABIQ Program is prepared to analyze ABi trace files and calculate
error probability for each base using a new version of the approach
described in (Lawrence,Solovyev,1994).
     We plan to develop these tools further to use in sequence
      EDITING/ASSEMBLING and study of HUMAN POLYMORPHISM.

If we observe different bases in several reads of some locus and
these bases have very small probability of errors, than we have a
good candidate of polymorphic site.

The program compute the PROBABILITY OF 3 TYPES OF BASE CALLING ERRORS
(Insertion - Overcall; deletion - Undercall and substitution - Miscall).


The program can be run at http://genomic.sanger.ac.uk/ of our
 Computational Genomic Group WEB server
 (http://genomic.sanger.ac.uk/abi/abi.shtml)

This version of program uses ABI base calling sequence, but we
plan to incorparate our version of base calling in the future, also we plan
to tune the quality prediction part for new ABI sequencers.

The Java viewer can be used for visual analysis of Trace files and
quality data.

References:

Solovyev V.V., Salamov A.A. Assignment of base quality and partition of
Overcall,
Undercall, Miscall and sequence polymorphism (unpublished data).

Seledtsov I.A., Solovyev V.V. Visual and computational analysys of ABI trace
data (unpublished data).

Lawrence C.B., Solovyev V.V. Assignment of Position-Specific Error
Probability to primary DNA Sequence Data.Nucl.Acids Res., 1994, 22,
7,1272-1280.

The program output includes :
 The sequence and probabilitoes of errors in 0-9 scale corresponding (0 -
100%).

 Sequence of ABI base calling in FASTA format
and Quality data for each base: Total quality and Overcall, Undercall and
Miscall, respectively. Quality scale is ( q = -10 Log (p)) similar with
the used in (Ewing and Green,1998, Genome Res.,8,186-194.

	Browse --> Load File ---> Show data

Example of output of the program:

A01U0005            " View ABI traces and Quality data " (Java viewer button)
                    10        20        30        40        50
            ACTATCATTAAAGATTCTGTCAATATTTAAAATAAGATGACAGATATAAT
 P over     00000000000000000000000000000000000000000000000000
 P under    00000000000000000000000000000000000000000000000000
 P mis      00000000000000000000000000000000000000000000000000
                    60        70        80        90       100
            TCATATTGTAGGCTCACATGTAAGCATTAAATAACCGATATACTAAACTA
 P over     00000000000000000000000000000000000000000000000000
 P under    00000000000000000000000000000000000000000000000000
 P mis      00000000000000000000000000000000000000000000000000
                   110       120       130       140       150
            TGCGATGCCTTCTTTAATCCTTCTTATTTTATTGTAGTCACTAAAATTTT
 P over     00000000000000000000000000000000000000000000000000
 P under    00000000000000000000000000000000000000000000000000
 P mis      00000000000000000000000000000000000000000000000000
                   160       170       180       190       200
            AGATTGGAATACTGCAGGAACTTAGTACAAGTCAAATGTGTTAATACTAC
 P over     00000000000000000000000000000000000000000000000000
 P under    00000000000000000000000000000000000000000000000000
 P mis      00000000000000000000000000000100000000000000000000
                   210       220       230       240       250
            ACATGGAAAGAATATTAGGAAACAAGCATTTGGTCACCTTCCAGTCATAA
 P over     00000000000000000000000000000000000000000000000000
 P under    00000000000000000000000000000000000000000000000000
 P mis      00000000000000000000000000000000000000000000000000
                   260       270       280       290       300
            AAGAGACTGAGGCAGAAATAATATGAACCAGGGCTGTATGTTTACCTAAG
 P over     00000000000000000000000000000000000000000000000000
 P under    00000000000000000000000000000000000000000000000000
 P mis      00000000000000000000000000000000000000000000000000
                   310       320       330       340       350
            ACAGTTGCACATAAGAATCAACTGGGGCATTTAAAACACAGCAACAACAA
 P over     00000000000000000000000000000000000000000000000000
 P under    00000000000000000000000000000000000000000000000000
 P mis      00000000000000000000000000000000000000000000000000
                   360       370       380       390       400
            TAACCCAAACAGTGATCCTGGGGCTCCATTCCAGACCCAACTTAATCAGT
 P over     00000300000000000000000000000000000001000000000000
 P under    00020000000000000010000000000000000000000000000000
 P mis      00100400000000000000000000000000000002000000000000
                   410       420       430       440       450
            ATTTCTGGAGGTTGGACACTGACGGCTGTTATTTTTCAAAGGCATCCCAG
 P over     00000000000000000000000010000000000000000100000100
 P under    00002100011200000000011000000001000011000000020000
 P mis      00000001010000000000010000000000040000000100010200

            GGTGGA
 P over     000000
 P under    000000
 P mis      010000
> A01U0005                       Length:   456
ACTATCATTAAAGATTCTGTCAATATTTAAAATAAGATGACAGATATAATTCATATTGTA
GGCTCACATGTAAGCATTAAATAACCGATATACTAAACTATGCGATGCCTTCTTTAATCC
TTCTTATTTTATTGTAGTCACTAAAATTTTAGATTGGAATACTGCAGGAACTTAGTACAA
GTCAAATGTGTTAATACTACACATGGAAAGAATATTAGGAAACAAGCATTTGGTCACCTT
CCAGTCATAAAAGAGACTGAGGCAGAAATAATATGAACCAGGGCTGTATGTTTACCTAAG
ACAGTTGCACATAAGAATCAACTGGGGCATTTAAAACACAGCAACAACAATAACCCAAAC
AGTGATCCTGGGGCTCCATTCCAGACCCAACTTAATCAGTATTTCTGGAGGTTGGACACT
GACGGCTGTTATTTTTCAAAGGCATCCCAGGGTGGA
> Total quality A01U0005
 99 99 69 49 43 49 69 32 99 69 62 43 99 49 49 99 69 49 69 99
 62 49 35 99 69 99 99 99 69 99 40 43 99 62 62 99 49 49 99 99
 99 62 49 99 99 99 99 69 49 99 99 99 99 99 69 99 99 99 99 99
 69 46 99 99 99 99 99 49 69 99 99 49 99 69 99 62 69 62 69 69
 99 99 99 69 69 49 69 99 99 99 99 99 99 99 69 69 99 99 99 69
 62 99 99 69 99 62 62 69 40 49 62 99 69 49 99 99 62 62 99 99
 49 99 99 69 49 99 99 69 69 99 99 99 99 99 99 99 69 99 99 99
 99 49 69 99 69 49 69 99 99 49 99 62 99 40 49 40 40 49 99 99
 99 69 69 49 69 62 40 69 49 62 49 35 69 99 49 49 99 69 49 25
 49 69 99 99 40 49 69 99 99 69 99 99 69 49 69 99 49 40 99 99
 99 62 69 35 49 40 49 49 40 40 40 49 69 99 69 69 69 48 49 40
 49 99 62 40 32 49 69 69 49 49 49 35 35 40 69 99 99 69 32 62
 69 35 40 62 99 62 99 49 69 99 49 35 40 69 62 99 49 62 40 69
 48 99 49 99 69 69 40 62 99 69 99 99 69 69 62 99 99 51 99 62
 69 69 40 62 62 62 69 99 99 69 99 69 69 99 69 62 46 49 99 62
 62 62 62 62 62 62 62 69 62 62 51 69 62 69 69 99 69 99 62 62
 69 69 62 48 48 40 62 69 62 51 99 69 69 99 69 69 62 51 62 51
 51 62 46 62 48 40 49 48 40 51 62 51 22 18 40  5 69 69 99 62
 40 51 46 40 69 46 31 51 27 48 31 51 49 62 40 28 51 32 62 51
 32 39 32 62 39 30 34 13 46 29 31 32 39 62 62 40 62 51 40 40
 69 62 33 28 17 26 32 25 28 20 24 15 35 46 40 31 51 32 51 62
 39 20 25 30 21 51 51 31 30 46 32 27 35  8 36 26 22 26 29 29
 36 19 40 51 46 16 30 14 32 28 39 22 29 30 39 39
> Overcall quality A01U0005
 99 99 69 49 43 49 69 32 99 99 69 43 99 49 49 99 99 49 69 99
 99 99 35 99 99 99 99 99 99 99 69 43 99 99 69 99 49 49 99 99
 99 99 49 99 99 99 99 99 49 99 99 99 99 99 99 99 99 99 99 99
 99 49 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 69 99 99
 99 99 99 99 99 49 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 69 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 69 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 37
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 37 99 99 10 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 49 99 19 99 32 99 99 99 99 99 99 99 99 99 99
 99 99 99 40 99 99 99 43 99 99 99 99 37 99 99 99 99 99 99 99
 99 43 99 99 24 99 99 99 99 99 99 99 99 49 99 43 99 99 37 35
 99 24 99 99 99 99 99 21 43 37 99 43 99 40 43 43
> Undercall quality A01U0005
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 69 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 69 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 69 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 52 99 99
 99 99 69 99 99 99 99 99 99 99 99 99 99 99 99 99 52 99 99 69
 99 99 69 69 99 69 69 99 69 99 52 99 69 99 99 99 99 99 69 69
 99 99 69 69 69 40 69 99 99 52 99 69 99 99 99 99 99 52 69 52
 52 69 52 99 69 40 99 69 40 52 99 52 99 18 69 99 99 99 99 99
 40 52 52 40 69 52 40 52 27 69 32 52 99 69 40 32 52 32 69 52
 52 40 32 69 40 99 52 99 52 99 32 32 40 69 99 40 69 52 40 40
 99 69 99 69 18 27 52 40 32 27 27 16 99 52 40 32 52 32 52 69
 52 27 27 32 99 52 52 32 32 52 32 27 69 32 40 32 22 27 99 69
 40 99 40 52 52 18 69 52 52 69 52 40 32 52 52 52
> Miscall quality A01U0005
 99 99 99 99 99 99 99 99 99 99 69 99 99 99 99 99 99 99 99 99
 69 49 99 99 99 99 99 99 99 99 40 99 99 69 69 99 99 99 99 99
 99 69 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99
 99 49 99 99 99 99 99 49 69 99 99 49 99 99 99 69 69 69 99 69
 99 99 99 99 99 69 99 99 99 99 99 99 99 99 69 69 99 99 99 69
 69 99 99 99 99 69 69 69 40 49 69 99 69 49 99 99 69 69 99 99
 49 99 99 99 49 99 99 69 69 99 99 99 99 99 99 99 99 99 99 99
 99 49 69 99 69 49 69 99 99 49 99 69 99 40 49 40 40 49 99 99
 99 69 99 49 69 69 40 69 49 69 49 35 69 99 49 49 99 69 49 27
 49 69 99 99 40 49 69 99 99 69 99 99 69 49 69 99 49 40 99 99
 99 69 69 35 49 40 49 49 40 40 40 49 69 99 69 69 69 49 49 40
 49 99 69 40 32 49 69 69 49 49 49 35 35 40 99 99 99 99 32 69
 69 35 40 69 99 69 99 49 69 99 49 35 40 69 69 99 49 69 40 69
 49 99 49 99 99 69 40 69 99 99 99 99 99 99 69 99 99 69 99 69
 69 69 40 69 69 69 99 99 99 99 99 99 99 99 69 69 49 49 99 69
 69 69 69 99 69 99 69 99 69 69 99 99 99 69 99 99 99 99 99 69
 99 99 69 49 49 99 69 99 69 99 99 99 99 99 99 69 69 99 99 69
 99 69 49 69 49 69 49 49 69 99 69 69 23 49 40  9 99 69 99 69
 69 99 49 99 99 49 33 99 99 49 49 99 49 99 69 33 69 99 69 99
 32 49 99 99 49 30 35 17 49 33 69 69 49 99 69 69 99 99 69 99
 99 99 33 30 33 49 33 27 32 23 33 30 49 49 69 49 99 99 69 99
 40 23 40 40 30 69 99 69 40 49 99 99 35  9 40 30 49 69 32 32
 40 23 69 69 49 27 30 17 35 30 40 23 35 33 49 49



-- 
Victor Solovyev
The Sanger Centre, Hinxton, Cambridge CB10 1SA, UK
Email: solovyev at sanger.ac.uk  http://genomic.sanger.ac.uk
Phone: 44-1223-494799  FAX:   44-1223-494919




More information about the Bio-www mailing list

Send comments to us at archive@iubioarchive.bio.net