GenBank Release 116.0 is now available via ftp from the National Center
for Biotechnology Information:
Ftp Site Directory Contents
---------------- --------- ---------------------------------------
ncbi.nlm.nih.gov genbank GenBank Release 116.0 flatfiles
ncbi-asn1 ASN.1 data used to create Release 116.0
Uncompressed, the Release 116.0 flatfiles require roughly 21350 MB
(sequence files only) or 23300 MB (including the 'index' files). The
ASN.1 version requires roughly 17967 MB. From the release notes:
Release Date Base Pairs Entries
115 Dec 1999 4653932745 5354511
116 Feb 2000 5805414935 5691170
In the nine-week period between close-of-data for GenBank 115.0 and
GenBank 116.0, GenBank grew by a record 1.151 billion basepairs.
Close-of-data was 02/18/2000. Thirteen days were required to prepare this
release. An unfortunate combination of events (production problems through
the second week of February, followed by machine and disk crashes) has
delayed 116.0 by two weeks. But the release date remains "February 15",
chiefly as a convenience for recording growth stats.
PLEASE NOTE: The author-name index file (gbaut.idx) for GenBank 116.0 will
not be available until the middle of next week, due to software problems that
arose today. Rather than delay GB 116.0 even further, we are making the
release available without the index file. Our apologies for any inconvenience
that this causes.
For additional release information, see the README files in either of the
directories mentioned above, and the release notes (gbrel.txt) in the
genbank directory. Sections 1.3 and 1.4 of the release notes (Changes in
Release 116.0 and Upcoming Changes) have been appended below.
Release 116.0 data are currently available via NCBI's Entrez and Blast
servers, and the 'query' email server.
New GenBank cumulative update files (gbcu.flat.Z and gbcu.aso.Z), containing
only those entries new/updated since the Release 116.0 close-of-data, should be
available by 6:00am EST, March 3. Please note that the new CUs will be
smaller than previous versions you might have obtained after Release 115.0 was
posted.
If you encounter problems while ftp'ing or uncompressing Release 116.0,
please send email outlining your difficulties to info at ncbi.nlm.nih.gov .
Mark Cavanaugh
GenBank
NCBI/NLM/NIH
1.3 Important Changes in Release 116.0
1.3.1 Organizational changes
Due to database growth, the EST division is now being split into forty-seven
pieces.
Due to database growth, the GSS division is now being split into sixteen
pieces.
Due to database growth, the HTG division is now being split into fourteen
pieces.
Due to database growth, the PRI division is now being split into five pieces.
1.3.2 Replacement of organelle-related qualifiers with /organelle
Starting with GenBank Release 116.0 (February, 2000), the various organelle-related
qualifiers (/mitochondrion, /chromoplast, /chloroplast, /kinetoplast, etc) have been
been incorporated into a single new qualifier, with a controlled value format. The
definition of this qualifier is as follows:
Qualifier /organelle=""
Definition type of membrane-bound intracellular structure from
which the sequence was obtained
Value format mitochondrion, nucleomorph, plastid, mitochondrion:kinetoplast,
plastid:chloroplast, plastid:apicoplast, plastid:chromoplast,
plastid:cyanelle, plastid:leucoplast, plastid:proplastid
Examples /organelle="mitochondrion"
/organelle="nucleomorph"
/organelle="plastid"
/organelle="mitochondrion:kinetoplast"
/organelle="plastid:chloroplast"
/organelle="plastid:apicoplast"
/organelle="plastid:chromoplast"
/organelle="plastid:cyanelle"
/organelle="plastid:leucoplast"
/organelle="plastid:proplastid"
Comments modifier text limited to values from controlled list
Reminder: complete Feature Table documentation is available at this URL:
http://www.ncbi.nlm.nih.gov/collab/FT/index.html
1.4 Upcoming Changes
1.4.1 Selenocysteine representation
Selenocysteine residues within the protein translations of coding
region features have been represented in GenBank via the letter 'X'
and a /transl_except qualifier. At the May collaborative meeting, it
was learned that IUPAC plans to adopt the letter 'U' for selenocysteine.
DDBJ, EMBL, and GenBank will thus use this new amino acid abbreviation
for its /translation qualifiers. Although a timetable for its appearance
has not been finalized, we are mentioning this now because the introduction
of a new residue abbreviation is a fairly fundamental change.
If conversion efforts go smoothly, the new selenocysteine abbreviation
will appear within a few months. Details about the use of 'U' will be made
available via these release notes and the GenBank newsgroup as they become
available.
1.4.2 Mutation and Allele features to be discontinued
Agreement was reached at the May 1999 collaborative DDBJ/EMBL/GenBank
meeting that the functionality provided by the variation, mutation, and
allele features could be represented by just a single feature, variation.
Submittors of sequence data are now being encouraged to use just the
variation feature. With GenBank Release 117.0, all existing mutation and
allele features will be converted to variation, and then mutation and
allele features will no longer be legal feature keys.
1.4.3 VRL division will be split into multiple files
The viral GenBank division (gbvrl.seq) will soon be split into multiple
files, since its size is approaching 300MB. This is likely to occur by
GenBank Release 117.0 (April 2000). The resulting files for VRL will be:
gbvrl1.seq and gbvrl2.seq .
1.4.4 New REFERENCE type for on-line journals
Agreement was reached at the May 1999 collaborative DDBJ/EMBL/GenBank
meeting that an effort should be made to accomodate references which are
published only on-line. Until specifications for such references are
available from library organizations, GenBank will present them in a manner
like this:
REFERENCE 1 (bases 1 to 2858)
AUTHORS Smith, J.
TITLE Cloning and expression of a phospholipase gene
JOURNAL Online Publication
REMARK Online-Journal-name; Article Identifier; URL
This format is still tentative; additional information about this new
reference type will be made available via these release notes.
---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca
