Hello,
A recent entry, CNS02BIT, in the EMBL and GenBank public databases
revealed a problem with the GCG program DBIndex. This program
is called by all of the GCG database formatting programs, including
EMBLToGCG and GenBankToGCG.
Though the entry appeared to format without error, in many
circumstances,
when you attempted to access that sequence with other GCG programs, the
following error message was reported:
*** ERROR in SQNext. Sequence reading is out of synch.
A solution for this problem can be obtained by contacting
the GCG Bioinformatics Support team at the address
mailto:help at gcg.com
--
Regards,
Lynn Miller, Bioinformatics Support Manager
----------------------------------------------------------------------
Genetics Computer Group, An Oxford Molecular Company
575 Science Drive, Madison, WI USA 53711
phone: (608)231-5200
GCG: help at gcg.comhttp://www.gcg.com
Oxford Mol: support at oxmol.comhttp://www.oxmol.com
----------------------------------------------------------------------
---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca