I am wondering whether anyone has experienced "skipping" of segments flanked
by long, direct repeats while performing PCR. We used a template (Contig
clone, human genomic, sequence is published), and obtained a pcr product
~100bp less than expected size. Our sequencing of the resultant clone
indicates a 100bp deletion, flanked by CCagCCCCCC (5'-3'). Could a loop
have formed such that Taq polymerase read right through? Any experiences
would be helpful. Thanks!!!!
Chad M. Kitchen
Technical Associate I
Center for Cardiovascular Research, Box 679
University of Rochester Medical Center
Ph. 716-273-1535
---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca
