IUBio GIL .. BIOSCI/Bionet News .. Biosequences .. Software .. FTP

human genome

VSim vsim at armenia.com
Mon Mar 25 22:46:12 EST 2002


New human genome site.

take a look to kinesin :
http://www.ncbi.nlm.nih.gov/IEB/Research/Acembly/av.cgi?db=28&l=G_t2_Hs2_319
16_28_1_3047

here is the main webpage:
    http://www.ncbi.nlm.nih.gov/IEB/Research/Acembly

VSim




- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  





More information about the Genbankb mailing list

Send comments to us at archive@iubioarchive.bio.net