I have a list of 5126 protein sequences with SwissProt ID or accession
number that I want to get the corresponding coding sequences from
Genbank, EMBL or other databases.
Although I can search NCBI web and got its gi number then from the gi
number link to get its corresponding mRNA sequence file, and then get
the CDS sequence, it is not a pracitical way to handle thousands of the
sequences I want. Is there a way to do this extraction of gene (CDS)
sequence according to swissprot IDs automatically?
Huaichun Wang
---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca
