IUBio GIL .. BIOSCI/Bionet News .. Biosequences .. Software .. FTP

GenBank CU Problem : Post Release 132.0

Mark Cavanaugh cavanaug at ncbi.nlm.nih.gov
Fri Nov 8 12:13:43 EST 2002


Greetings GenBank Users,

Some of you have no doubt noticed that there is still
no post-132.0 GenBank Cumulative Update available at
the NCBI website:

        ftp://ftp.ncbi.nih.gov/ncbi-asn1/daily/gbcu.aso.gz
        ftp://ftp.ncbi.nih.gov/genbank/daily/gbcu.flat.gz

Unfortunately, a problem occurred with one of our replicant
sequence databases. Since we dump from the replicant side in 
order to generate our update products, we haven't been able
to generate a new CU .

We hope to provide the post-132.0 CU by Saturday morning.
Our apologies for any inconvenience that this CU downtime
may have caused.

Mark Cavanaugh
GenBank
NCBI/NLM/NIH

---


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  





More information about the Genbankb mailing list

Send comments to us at archive@iubioarchive.bio.net