Hi Kevin:
As shown in those posts, no one at NCBI ever took
credit for fixing the problem, so cause-effect
was never established. Current postings to genbank
newsgroup indicate rash of tech problems at NCBI now,
so perhaps this is a sympathetic problem.
Just tried the same connect you tried -- seems to
be okay from my site, for now.
Garry Martin
Mendel Bioinformatics
---------------------
>Date: Mon, 6 Jan 2003 17:25:21 -0500
>Mime-Version: 1.0 (Apple Message framework v482)
>Subject: re: ncbi ftp problems
>From: Kevin Murphy <murphy at genome.chop.edu>
>To: gmartin at MendelBio.COM>Content-Transfer-Encoding: 7bit
>>Garry,
>>I saw an old post of yours from last May regarding problems accessing
>the NCBI ftp server. I am having the same problems, and it's driving me
>mad.
>>Did you discover a solution?
>>Here's a typical session:
>>$ ftp ftp.ncbi.nlm.nih.gov
>Connected to ftp.ncbi.nih.gov.
>220-
> Warning Notice!
>421 Service not available, remote server has closed connection
>ftp>
>>Thanks,
>Kevin Murphy
>eGenome Project
>Children's Hospital of Philadelphia
---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca
