The data/software issues that caused problems in our
first atttempt to build GB 133.0 are not related to
any difficulties that users might have connecting to
the NCBI FTP server.
Occasionally, local firewall configurations can lead
to FTP problems. Using a 'passive mode' connection will
sometimes help.
>From Garry Martin's original report of unresponsive
FTP sessions :
> Looking at our system firewall logs, we can see that NCBI's new ftp
> server is responding with an ident request, probably for rarp purposes.
> We normally drop ident, but for these tests we made sure to allow them.
> The result is the same -- a partial display of your banner message
> and an unresponsive session, as shown here, using the Linux ftp client:
>> ftp -p ftp1.ncbi.nih.gov
> Connected to ftp1.ncbi.nih.gov (130.14.29.21).
> 220-
> Warning Notice!
We would be very interested to know if this problem is
still occurring (using 'ftp' instead of 'ftp1') :
ftp -p ftp.ncbi.nih.gov
If so, we will re-raise the issue with NCBI systems staff.
If it isn't happening any longer, then this might point the
way for Kevin Murphy : try a passive-capable FTP client .
Mark Cavanaugh
NCBI/NLM/NIH
> To: genbank at net.bio.net> Date: 7 Jan 2003 00:22:04 -0000
> From: Garry Martin <gmartin at MendelBio.COM>
> Subject: re: ncbi ftp problems
> X-Virus-Scanned: by amavisd-milter (http://amavis.org/)
> X-Filter-Version: 1.8 (mail-blade4)
>>> Hi Kevin:
>> As shown in those posts, no one at NCBI ever took
> credit for fixing the problem, so cause-effect
> was never established. Current postings to genbank
> newsgroup indicate rash of tech problems at NCBI now,
> so perhaps this is a sympathetic problem.
>> Just tried the same connect you tried -- seems to
> be okay from my site, for now.
>> Garry Martin
> Mendel Bioinformatics
> ---------------------
>>> >Date: Mon, 6 Jan 2003 17:25:21 -0500
> >Mime-Version: 1.0 (Apple Message framework v482)
> >Subject: re: ncbi ftp problems
> >From: Kevin Murphy <murphy at genome.chop.edu>
> >To: gmartin at MendelBio.COM> >Content-Transfer-Encoding: 7bit
> >
> >Garry,
> >
> >I saw an old post of yours from last May regarding problems accessing
> >the NCBI ftp server. I am having the same problems, and it's driving me
> >mad.
> >
> >Did you discover a solution?
> >
> >Here's a typical session:
> >
> >$ ftp ftp.ncbi.nlm.nih.gov
> >Connected to ftp.ncbi.nih.gov.
> >220-
> > Warning Notice!
> >421 Service not available, remote server has closed connection
> >ftp>
> >
> >Thanks,
> >Kevin Murphy
> >eGenome Project
> >Children's Hospital of Philadelphia
>> ---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca
