IUBio GIL .. BIOSCI/Bionet News .. Biosequences .. Software .. FTP

GB Release 141.0 Problem : rel141.fsa_aa

Mark Cavanaugh cavanaug at ncbi.nlm.nih.gov
Mon Apr 26 14:23:41 EST 2004


Greetings GenBank Users,

The FASTA file for proteins that are annotated as coding regions on GenBank
records which was installed on Saturday, April 24th:

   -r--r--r--   1 cavanaug gbrel    301055803 Apr 24 22:01 rel141.fsa_aa.gz

contained 13,814 duplicated sequences as a result of incorrectly processing
one of the classes of data that contributes to the CON division of Release 141.0.

This problem was fixed on Monday, April 26th and a new version of the 
file was installed at about 2:00pm EDT:

   -r--r--r--   1 cavanaug gbrel    299081010 Apr 26 14:01 rel141.fsa_aa.gz

Our thanks to a user at Novartis for pointing out the problem. The scrutiny
of data products provided by GenBank users is greatly appreciated by NCBI.

Mark Cavanaugh
GenBank
NCBI/NLM/NIH/DHHS

---


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at bioinformatics.ubc.ca                  





More information about the Genbankb mailing list

Send comments to us at archive@iubioarchive.bio.net