Dear Dr. Bernardi,
Because of the way that EST and GSS sequences are processed at GenBank,
we do not have a version of AI791495 as it appeared on 7/2/1999, and
thus we cannot compare that version to the record's current state.
However, I *can* tell you that the update did not affect the sequence.
I have asked dbEST staff to check their correspondence: perhaps the nature
of the 12/13/1999 update will be indicated there. If not... perhaps a site
somewhere has archived a copy of the August 1999 GenBank release (113.0),
and AI791495 can be extracted from one of the EST sequence files?
We do not archive old releases ourselves... but perhaps some reader of
this forum knows of a site that does?
We will contact you if our search of the correspondence from EST submitters
reveals any information about AI791495 .
Regards,
Mark Cavanaugh
GenBank
NCBI/NLM/NIH/HHS
>From: [iso-8859-1] BERNARDI C=E9line [mailto:CBERNARDI at rd.loreal.com]
>Sent: Thursday, March 24, 2005 9:29 AM
>To: genbank at net.bio.net>Subject: Information about an EST sequence
>>Dear Sirs,=20
>>I send you this email in order to have specific information
>about the EST
>which has the Accession number AI791495.=20
>>Indeed, I have seen that this sequence was first seen at NCBI
>on July 2,
>1999; it was then updated on December 13, 1999.
>>How can I see the first version (of July 2)? Is it possible to see the
>different modifications which occurred between July 2 and December 13?
>>Thank you in advance for your response,=20
>>Best regards,=20
>C=E9line BERNARDI=20
---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at bioinformatics.ubc.ca
