Well you should really show that you have thought about the problem,
before just blindly asking for someone to come up with the solution.
Just asking will not help you in the long term.
Get a good biochemistry book (Stryer, Voet, Matthews etc.) and a
molecular biology book (Freifelder etc.)
You have a palindromic sequence, AT rich region (multiple 2 Hbonds) GC
rich region (multiple 3 Hbond region)
Think about :
Random Coil
Hbonding (interstrand - obviously) thermodynamically what would GC rich
region confer ?
measure denaturing temp.
intrastrand H-bonding
HPhobic interactions (BASE STACKING - nice flat organic molecules
with water about them, what will they do ? Cluster -> Helix
disrupt Hphobic with methanol, TFA, NaCl measure denaturing temp.
measure base stackin (CD, ORD)
Cooperative base stacking
VdW attractions)
amount of 'fraying' at the ends (lack of Hbonding) - what sequenses
give more/less ?
DNA 'brething' (mportant) - what sequences most likely give it ?
motifs -hairpin turns / stem and loop
For 25 base pairs i think microscopies really out, only used on V.large
sections of DNA - giving a gross structure (strand)
NMR - TOCSY, NOESY, INADEQUATE
The higher the % of helix, the stronger pattern seen with X-ray
diffract.
These are just some thoughts, you really should read up on this in the
library.
HTH
DH
Paralee PK <paraleepk at aol.com> wrote in article
<1998090904080000.AAA18636 at ladder01.news.aol.com>...
> I'm taking a molecular biology class. The professor gave us a
problem set. He
> said we could ask anyone for help. I'm asking you! Here's the
problem:
> You want to determine the 3-D structure of a 25 base pair
oligonucleotide
> duplex. The sequence is:
> 5'TTTTTAAAAATTTTTGGGGGGGGGG3'
> 3'AAAAATTTTTAAAAACCCCCCCCCC5'
>> A. Describe the kinds of secondary and tertiary DNA structues that
youmight
> expect to find in the DNA.
> B. Propose a multi-approach experimental strategy for testing your
hypotheses.
> Describe the kinds of information each approach would provide,
andhow the
> approach could be used to confirm or discount your hypotheses. What
could be
> the alternative outcomes and conclusions?
>> I was considering making a flow chart of the approaches and possible
outcomes.
> We've been talking about the various microscopies, NMR and
crystallography.
> I'm assuming we would use those methodologies.
>> Thanks.
>>