IUBio GIL .. BIOSCI/Bionet News .. Biosequences .. Software .. FTP

Actin Primers: Summary.

BENNY SHOMER 9238 pc386 at ccsg.tau.ac.il
Thu Sep 2 11:47:20 EST 1993


Hello Everyone.

A while ago I have posted a request on the net, asking for good and well
tested PCR primers for actin.
There was much interest. I have received many replies, and also requests
from people to pass the info on. 
I have compiled the data that I have obtained. Where sequences appear, 
it is with permission of the author.
I want to take this opportunity and sincerely thank all the people who 
have spent their valuable time to write me, and to share their knowledge 
with other people. 
Following this thread, I came up with the idea that a gopher server will 
be set up, maintaining a database of __TESTED_&_WORKING__ sets of PCR 
primers (Sequences of course. We still can't download DNA by ftp  :-( ).
I believe such a database will save zillions of planning and testing 
hours since it can also hold data regarding cycle & thermal conditions.
A routine call can be Xposted every once in a while on bionet.xxxxxx, 
requesting data on a standard electronic form (or update via gopher ? ),
for researchers to submmit primers for th edatabase.
Would anyone pick up the glove ???

Here is the summary.
+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++

1.  Some people have suggested the primers of Clontech. Some have tested 
them and found them to be O.K.  However, if you buy these, you have to 
pay for the sequence data. Regarding my previous suggestion, you may 
guess what is my reaction to that...

2. This is from James F. George from Univ. Ala. @ Birmingham, USA.
Primers for human actin.

>We have some actin primers that we have been using for about two years
>now, and they work very well.  Using these primers, you should expect a
>product of about 1126bp.  

>You should use an annealing temperature of 60 C for 2 minutes and
>extension at 72 C for three minutes
>Upstream: ATG GAT GAT GAT ATC GCC GCG

>Downstream: CTA GAA GCA TTT GCG GTG GAC GAT GGA GGG GCC

3. This is from Bob Horton ("Bob who?"), from U. of Minnesota, CBS.
>Here are my actin primer sequences. They have proved quite useful
>in our hands as positive controls. They match cytoskeletal beta and 
>gamma actins from humans and mice exactly, and I have tried them on cow 
>cDNA as well. They are used with a 55oC annealing temperature and make
> a 542 bp product.

>ACTIN.5
>5'-gctccggcatgtgcaa-3'

>ACTIN.3
>5'-aggatcttcatgaggtagt-3'
This came also with a reference:
>Hoppe, B.L., Conti-Tronconi, B.M., and Horton, R.M. Gel loading dyes 
>compatible with PCR. BioTechniques 12:679-680.

>Please don't be put off by the relatively weak bands shown in the 
>figure.
>Those reactions were done in a circulating-air cycler; we get better 
>signals 
>with these primers in our new "real" PCR machine (presumably because 
>its easier to get the temperatures right...). The loading dye really 
>works, too :)

4. This came from Viraj Master from the Dept of Org. Biol.  University 
of Chicago.:
>We have some EXCELLENT actin primers which always work for RT-PCR from 
>any, and I mean any species.  We aligned all the actins we could find 
>(everything from mouse to moth) and came up with:

>upstream primer
>aa sequence:  MVGMGQK

>nt seq: 5' ATG GTN GGN ATG GGN CAR AAR (in retrospect I would leave out 
>the last R)


>downstream primer
>aa seq:  TFQQMWI

>nt seq: 5' DAT CCA CAT YTG YTG RAA NGT

>These primers always work, no matter what annealing temp we use, no 
>matter how
>small our starting amount of cDNA (we work on 1-10 stem cell pools from 
>a glossiphonid leech).  Other people who work on fish, mouse, human, 
>drosophila
>and Xenopus have used these sucessfully every time. 

5. This came in from Allen Black, Univ. of Alabama at Birmingham
Dept. of Microbiology.
>Primers for mouse beta-actin (540 bp).
>Up:   5'  gtgggccgctctaggcaccaa  3'
>Down: 5'  ctctttgatgtcacgcacgatttc   3'

Allen's primers are tested for RT-PCR. Cycle conditions are:
95C / 2 min' X1
94C / 45sec - 60C / 2min  -  72C / 3min  X35
72C / 7min.

6.  Loren Joseph from the University of Chicago, Department of Pathology 
wrote:

>I have a pair of primers which work reasonably well and span
>an intron but I advise against using any actin primers. There
>are 20-40 pseudogenes which lack introns.  At least several
>amplify well so unless you are already sure your RNA prep is
>DNA free, don't use actin (or GAPDH) primers. About four or
>five months ago BioTechniques had an article on primers for the
>non erythrocyte form of porphobilinogen deaminase which is 
>allegedly universally expressed. I have used shortened versions
>of the primers, with several slightly degenerate sites so that 
>both rodent and human cDNA are detectable with one primer pair.
>The level of PBGD is also closer to that of the RNAs I am interested 
>in.I will be happy to send you the sequences if you desire.

I have asked several people who amplify actin signals, and they have not 
run into such a problem as Loren describes. Anyway, I believe it should 
pose no problem to test this out, by including a repeat that containes 
DNAse free RNAse in the sample prior to the RT. If DNA is present, it 
will amplify. Another thing that might be done, is to reduce the 
denaturation temperature for the first few cycles. The newly synthesized 
cDNA will be free to anneal, whereas most chances for genomic DNA are, 
not to denature, and not to anneal.

*****************************************

I want to thank again all the colleagues, that replied/ suggested/ sent 
sequences, and also made them available to all.

Best wishes to everyone.
Sincerely yours, Benny Shomer.
 
 **************************************************************
* Benny Shomer                                                 *
* Tel-Aviv University                                          *
* Sackler School of Medicine, Dept.of Embryology and Teratology*
*--------------------------------------------------------------*
* Snail:  Ramat-Aviv , Tel-Aviv  69978 ,  Israel.              *
* E-mail :  pc386 at ccsg.tau.ac.il                               *
* Tel :  972-3-640-9238     FAX :   972-3-642-2046             *
*                                                              *
 %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% 
%        So Many Computers , So Little Time ...                %
%                                                              %
 %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%



More information about the Virology mailing list

Send comments to us at archive@iubioarchive.bio.net